-
Biogenic sediment history from diatom remains in cores along Wilkes Land
Preliminary data set contains details of cores processed (eg. sample name/interval, dry weights, reactions, notes) and the methodology used. The future data set will document... -
Hydrographic survey HI634 by the RAN Australian Hydrographic Service at...
The Australian Antarctic Division identified areas that required hydrographic surveying. (See map available in the download at \Plans and Instructions\HPS Supplied... -
Wave acquisition stereo-camera system measurements (WASS) from a voyage of...
Between 07:00 and 08:00 UTC on the 4th July 2017, the South African icebreaker S.A. Agulhas II entered the Antarctic MIZ (62 South and 30 East) during an explosive polar... -
CTD data of cruise in2018_v05 of the RV Investigator
Oceanographic measurements were collected aboard RV Investigator cruise in1805 (CSIRO voyage designation in2018_v05) from 16th October to 16th November 2018, along a number of... -
Hydrocarbon exposure concentrations for bioassays 09_10 - Davis Station
This dataset contains the results of replicate experiments which measured the total hydrocarbon content (THC) in water accommodated fractions (WAFs) of three fuels; Special... -
Studies of Beaks and Parasites of Antarctic Cephalopods
Metadata record for data expected ASAC Project 11 See the link below for public details on this project. From the abstract of the referenced paper: The Australian Antarctic... -
Log of observations of seals, penguins, skuas, petrels, and whales at Davis, 1957
This file contains a log of biological observations made in the Davis region during 1957. It includes information on Elephant Seals, Leopard Seals, Crabeater Seals, Adelie... -
Sea Ice Observations from the Nathaniel B Palmer 95-5b
These data describe pack ice characteristics in the Antarctic sea ice zone. These data are in the ASPeCt format. National program: United States Vessel: Nathaniel B. Palmer... -
Amery Ice Shelf - hot water drill borehole, 2005-06 - AM04 drilling parameters data
AM04 borehole drilled January 2006. Data collected in series of files over a period of 4 days during production of borehole. Consult Readme file for detail of data files and... -
Zooplankton abundance based on RMT1 net during SIPEX winter-spring transition
Zooplankton were collected during the winter-spring transition with an RMT8+1 net during the SIPEX voyage in 2007. Only the RMT1 data are presented here. The net was deployed on... -
Krill microbiome
Krill-associated bacterial communities characterised by high-throughput DNA sequencing of the 16S ribosomal RNA gene. The data is decribed in 'Clarke LJ, Suter L, King R,... -
Structure and geochemistry of Macquarie Island oceanic crust
Owing to the fact that the principal investigator died before data were able to be archived, the only available data are in the form of the referenced paper, which is available... -
Contribution of dinoflagellates to Antarctic coastal zone carbon flux
Some scanning electron microscope images were taken of dinoflagellates sampled as part of this project. A catalogue of the images taken is provided as part of the download file... -
Sea Surface Temperature Warming Rates in Australian Marine Parks according...
This dataset measures the mean decadal warming rates of the sea surface temperature (SST) in 58 Australian Marine Parks (with the exception of the Heard Island and McDonald... -
Resonance plays a secondary role in amplifying underwater vocalizations of...
The date are of the highest amplitudes across the frequency range of Weddell seal tonal trills (an underwater call made by males). Each column presents the results of a... -
Site occupancy by breeding Adelie penguins in East Antarctica
This dataset collates data on occupancy of geographic sites by breeding Adelie penguins across east Antarctica between 37 degrees E -160 degrees E from the 1950s to the present... -
Diving Petrel (Pelecanoides) data tables from Heard Island - circa 1948-1960
These data tables were scanned by Fiona Gleadow. The data relate to diving petrels (Pelecanoides) from Heard Island, and generally appear to be measurements of body parts... -
Opal concentrations measured in sediment samples collected during the...
Sediment cores were collected from the East Antarctic margin, aboard the Australian Marine National Facility R/V Investigator from January 14th to March 5th 2017 (IN2017_V01;... -
Aurora Australis Voyage 3 2012/13 Track and Underway Data
On every voyage of the Aurora Australis, approximately 50 onboard sensors collect data on average every 10 seconds. These data are known as the underway datasets. The type of... -
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG,...