-
Southern Ocean eDNA metabarcoding raw sequencing data, collected on the...
On the return leg of the V1 2019 resupply voyage from Davis station to Hobart on the RSV Aurora Australis paired, open ocean environmental DNA (eDNA) samples were taken at 29... -
Euphausiid-specific metabarcoding data from eDNA samples collected on the...
This is a Euphausiid-specific metabarcoding dataset of Southern Ocean eDNA samples collected on the TEMPO voyage in 2021. We collected eDNA samples by filtering five litres of... -
Voyage 4 of the Aurora Australis, 2018 environmental DNA samples analysed...
In March 2018, 23 environmental DNA (eDNA) samples (2 L of filtered seawater) were collected between Hobart, Tasmania and subantarctic Macquarie Island. These samples were... -
V4 2018 eDNA, genetic CPR and large-volume eDNA raw sequencing data
In this data set we examined whether eDNA samples can detect similar numbers of species and community compositions as genetic continuous plankton recorder (CPR) samples. On the... -
eDNA metabarcoding data of a long-distance Southern Ocean transect - RV...
These data accompany the paper 'Long-distance Southern Ocean environmental DNA (eDNA) transect provides insights into spatial marine biota and invasion pathways for non-native... -
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG,... -
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG,... -
V4 2018 eDNA, genetic CPR and large-volume eDNA raw sequencing data
In this data set we examined whether eDNA samples can detect similar numbers of species and community compositions as genetic continuous plankton recorder (CPR) samples. On the... -
Voyage 4 of the Aurora Australis, 2018 environmental DNA samples analysed...
In March 2018, 23 environmental DNA (eDNA) samples (2 L of filtered seawater) were collected between Hobart, Tasmania and subantarctic Macquarie Island. These samples were... -
eDNA metabarcoding data of a long-distance Southern Ocean transect - RV...
These data accompany the paper 'Long-distance Southern Ocean environmental DNA (eDNA) transect provides insights into spatial marine biota and invasion pathways for non-native... -
Southern Ocean eDNA metabarcoding raw sequencing data, collected on the...
On the return leg of the V1 2019 resupply voyage from Davis station to Hobart on the RSV Aurora Australis paired, open ocean environmental DNA (eDNA) samples were taken at 29... -
Euphausiid-specific metabarcoding data from eDNA samples collected on the...
This is a Euphausiid-specific metabarcoding dataset of Southern Ocean eDNA samples collected on the TEMPO voyage in 2021. We collected eDNA samples by filtering five litres of...
1 - 12 of 12 results