{"help": "https://data.gov.au/data/en/api/3/action/help_show?name=package_show", "success": true, "result": {"archived": false, "author_email": null, "contact_point": "metadata@aad.gov.au", "creator_user_id": "c2fbbe4a-4ba0-4945-808b-67454605a4cf", "duplicate_score": 2, "geospatial_topic": [], "id": "6d4475a9-6265-49da-9a1f-e0c5c9358f5c", "isopen": false, "language": "eng", "license_id": "notspecified", "license_title": "notspecified", "maintainer": null, "maintainer_email": null, "metadata_created": "2025-11-17T15:48:32.708046", "metadata_modified": "2025-11-17T15:48:32.708054", "name": "southern-ocean-edna-metabarcoding-raw-sequencing-data-collected-on-the-aurora-austral-2019-20201", "notes": "On the return leg of the V1 2019 resupply voyage from Davis station to Hobart on the RSV Aurora Australis paired, open ocean environmental DNA (eDNA) samples were taken at 29 locations along the voyage. Sample names, sample coordinates as well as a range of environmental variables at each location are listed in file \u2018V1 2019 Samples.xlsx\u2019. Each sample pair consisted of one 2 L sample filtered through a 0.45 \u03bcm pore size filter, and one 12 L sample filtered through a 20 \u03bcm pore size filter. Filtering happened on board immediately after sampling. Filters of the 2 L samples were halved and stored in separate tubes, then immediately frozen at -80 \u02daC. Filters of the 12 L samples were stored whole and also frozen at -80 \u02daC. DNA of all samples was extracted at the specialised lab \u2018eDNA frontiers\u2019 located at Curtin University, WA using DNeasy Blood and Tissue Kits, and the extracted DNA sent back to the genetics lab at the Australian Antarctic Division (AAD). Several metabarcoding approaches were conducted to survey metazoan biodiversity present in these samples:\n-   A marker targeting the mitochondrial gene cytochrome c oxidase I (COI) using metazoan specific primers (Forward primer mlCOIintF: GGWACWGGWTGAACWGTWTAYCCYCC; reverse primer jgHCO2198). This marker was used twice, using identical PCR conditions (95 \u00b0C for 10 min, a 16 cycle touchdown phase (62 \u00b0C -1 \u00b0C per cycle), followed by 25 cycles with an annealing temperature of 46 \u00b0C (total of 41 cycles), and a final extension at 72 \u00b0C for 5 min). : once using a two PCR step method, using MID tagged primers in the first round of PCR, and MID tagged Illumina sequencing adapters in the second round of PCR (second round PCR conditions using MID tagged Illumina sequencing adapters with this and all other markers listed below were: 95 \u00b0C for 10 min, 10 cycles of 95 \u00b0C for 30 sec, 55 \u00b0C for 30 sec and 72 \u00b0C for 45 sec, and a final extension at 72 \u00b0C for 5 min). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder \u2018COI dual tagged\u2019. The second method used a one round PCR with fusion tagged primers, conducted at Curtin University and sequenced there as well. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder \u2018COI fusion tagged\u2019. \n-   A marker targeting the mitochondrial 16S rRNA gene, using fish specific primers (Forward primer Fish_F: GACGAGAAGACCCYRTGRAG; reverse primer Fish_R GACGAGAAGACCCYRTGRAG) with the following PCR conditions: 95 \u00b0C for 10 min, 45 cycles of 95 \u00b0C for 30 sec, 60 \u00b0C for 30 sec and 72 \u00b0C for 45 sec, and a final extension at 72 \u00b0C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder \u2018Fish\u2019.\n-   A marker targeting the mitochondrial 16S rRNA gene, using mammal specific primers (Forward primer Mammal_F: CAATTTNGGTTGGGGTGA; reverse primer Mammal_R GGATTGCGCTGTTATCCCTA) with the following PCR conditions: 95 \u00b0C for 10 min, 45 cycles of 95 \u00b0C for 30 sec, 56 \u00b0C for 30 sec and 72 \u00b0C for 45 sec, and a final extension at 72 \u00b0C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder \u2018Mammal\u2019.\n-   A marker targeting the mitochondrial 16S rRNA gene, using krill specific primers (Forward primer Crust_F: GTGACGATAAGACCCTATA; reverse primer Crust_R ATTACGCTGTTATCCCTAAAG) with the following PCR conditions: 95 \u00b0C for 10 min, 45 cycles of 95 \u00b0C for 30 sec, 56 \u00b0C for 30 sec and 72 \u00b0C for 45 sec, and a final extension at 72 \u00b0C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder \u2018Krill\u2019.\nUsing the fish and mammal specific metabarcoding markers, we detected the presence of several fish and marine mammal species in a subset of eDNA samples. These markers were tested again with a number of additional markers:\n-   A marker targeting the mitochondrial control region, using whale specific primers (Forward primer Dloop_1.5_F: CCACAGTACTATGTCCGTATT; Reverse primer Dlp4_R: GCGGGWTRYTGRTTTCACG) with the following first round PCR conditions: 95 \u00b0C for 10 min, 40 cycles of 95 \u00b0C for 30 sec, 54 \u00b0C for 30 sec and 72 \u00b0C for 45 sec, and a final extension at 72 \u00b0C for 5 min. First round markers were untagged. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder \u2018Whale DLoop 1.5\u2019.\n-   A marker targeting the mitochondrial control region, using whale specific primers (Forward primer Dloop_10_F: TCACCCAAAGCTGRARTTCTA; Reverse primer Dlp4_R: GCGGGWTRYTGRTTTCACG) with the following first round PCR conditions: 95 \u00b0C for 10 min, 40 cycles of 95 \u00b0C for 30 sec, 54 \u00b0C for 30 sec and 72 \u00b0C for 45 sec, and a final extension at 72 \u00b0C for 5 min. First round markers were untagged. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder \u2018Whale DLoop 10\u2019.\n-   A marker targeting the mitochondrial control region, using a nested PCR approach with whale specific primers (First round forward primer Dloop_1.5_F: CCACAGTACTATGTCCGTATT; Reverse primer Dloop_5_R: CCATCGWGATGTCTTATTTAAGRGGAA. Second round forward primer Dloop_1.5_F: CCACAGTACTATGTCCGTATT, reverse primer Dlp4_R: GCGGGWTRYTGRTTTCACG) with the following first round PCR conditions: 95 \u00b0C for 10 min, 40 cycles of 95 \u00b0C for 30 sec, 54 \u00b0C for 30 sec and 72 \u00b0C for 45 sec, and a final extension at 72 \u00b0C for 5 min, and identical second round PCR conditions with the exception of only 20 cycles of amplification. First round markers as well as Illumina adaptors were MID tagged. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder \u2018Whale DLoop Nested\u2019.\n-   A marker targeting the mitochondrial 16S rRNA gene using vertebra specific, MID tagged primers (Forward primer MarVer3_F: AGACGAGAAGACCCYRTG; reverse primer MarVer3_R: GGATTGCGCTGTTATCCC) with the following first round PCR conditions: 95 \u00b0C for 10 min, 40 cycles of 95 \u00b0C for 30 sec, 54 \u00b0C for 30 sec and 72 \u00b0C for 45 sec, and a final extension at 72 \u00b0C for 5 min. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder \u2018Vertebra\u2019.", "num_resources": 4, "num_tags": 17, "organization": {"id": "0143757a-86ab-43e4-bba6-4a3a2a02b6c4", "name": "australian-ocean-data-network", "title": "Australian Ocean Data Network", "type": "organization", "description": "Harvester for Australian Ocean Data Network", "image_url": "", "created": "2025-06-23T12:29:10.320926", "is_organization": true, "approval_status": "approved", "state": "active"}, "original_harvest_source": {"site_url": "https://catalogue.aodn.org.au", "href": "https://catalogue.aodn.org.au/geonetwork/srv/eng/csw/dataset/southern-ocean-edna-metabarcoding-raw-sequencing-data-collected-on-the-aurora-austral-2019-20201", "title": "Australian Oceans Data Network"}, "owner_org": "0143757a-86ab-43e4-bba6-4a3a2a02b6c4", "private": false, "promotion_level": "0", "spatial": "{\"type\": \"Polygon\", \"coordinates\": [[[77.2145, -68.0036], [147.4927, -68.0036], [147.4927, -43.2379], [77.2145, -43.2379], [77.2145, -68.0036]]]}", "spatial_coverage": "{\"type\": \"Polygon\", \"coordinates\": [[[77.2145, -68.0036], [147.4927, -68.0036], [147.4927, -43.2379], [77.2145, -43.2379], [77.2145, -68.0036]]]}", "state": "active", "temporal_coverage_from": "2019-11-16 00:00:00", "temporal_coverage_to": "2019-11-26 00:00:00", "title": "Southern Ocean eDNA metabarcoding raw sequencing data, collected on the Aurora Australis 2019-2020", "type": "dataset", "unpublished": false, "url": null, "version": null, "extras": [{"key": "harvest_object_id", "value": "4fe495c4-13b9-4743-92d0-af0663c1c16c"}, {"key": "harvest_source_id", "value": "a2216e59-91ec-48b1-83cc-d35d9f09fcec"}, {"key": "harvest_source_title", "value": "Australian Oceans Data Network"}], "resources": [{"cache_last_updated": null, "cache_url": null, "created": "2025-11-17T15:48:32.710823", "datastore_active": false, "datastore_contains_all_records_of_source_file": false, "description": "Download the dataset", "format": "HTML", "hash": "", "id": "c632a8db-e4ab-4e8b-8c83-061809029067", "last_modified": null, "metadata_modified": "2025-11-17T15:48:32.676973", "mimetype": null, "mimetype_inner": null, "name": "GET DATA > DIRECT DOWNLOAD", "package_id": "6d4475a9-6265-49da-9a1f-e0c5c9358f5c", "position": 0, "resource_locator_function": "fileAccess", "resource_locator_protocol": "WWW:LINK-1.0-http--link", "resource_type": null, "size": null, "state": "active", "url": "https://data.aad.gov.au/eds/5450/download", "url_type": null, "zip_extract": false}, {"cache_last_updated": null, "cache_url": null, "created": "2025-11-17T15:48:32.710828", "datastore_active": false, "datastore_contains_all_records_of_source_file": false, "description": "Public information for AAS project AAS_4556", "format": "HTML", "hash": "", "id": "6d3dbc2a-4b23-498c-8773-ad8f37c596da", "last_modified": null, "metadata_modified": "2025-11-17T15:48:32.677125", "mimetype": null, "mimetype_inner": null, "name": "PROJECT HOME PAGE", "package_id": "6d4475a9-6265-49da-9a1f-e0c5c9358f5c", "position": 1, "resource_locator_function": "fileAccess", "resource_locator_protocol": "WWW:LINK-1.0-http--link", "resource_type": null, "size": null, "state": "active", "url": "https://secure3.aad.gov.au/proms/public/projects/report_project_public.cfm?project_no=AAS_4556", "url_type": null, "zip_extract": false}, {"cache_last_updated": null, "cache_url": null, "created": "2025-11-17T15:48:32.710830", "datastore_active": false, "datastore_contains_all_records_of_source_file": false, "description": "Citation reference for this metadata record and dataset.", "format": "HTML", "hash": "", "id": "56f4d07f-a01a-4f42-86d0-98959fe5c31b", "last_modified": null, "metadata_modified": "2025-11-17T15:48:32.677231", "mimetype": null, "mimetype_inner": null, "name": "VIEW RELATED INFORMATION", "package_id": "6d4475a9-6265-49da-9a1f-e0c5c9358f5c", "position": 2, "resource_locator_function": "fileAccess", "resource_locator_protocol": "WWW:LINK-1.0-http--link", "resource_type": null, "size": null, "state": "active", "url": "https://data.aad.gov.au/aadc/metadata/citation.cfm?entry_id=AAS_4556_V1_eDNA_metabarcoding_raw_sequencing_data", "url_type": null, "zip_extract": false}, {"cache_last_updated": null, "cache_url": null, "created": "2025-11-17T15:48:32.710831", "datastore_active": false, "datastore_contains_all_records_of_source_file": false, "description": "", "format": "PNG", "hash": "", "id": "0fdbf691-666c-4944-8dc8-fd00be276127", "last_modified": null, "metadata_modified": "2025-11-17T15:48:32.677329", "mimetype": null, "mimetype_inner": null, "name": "Creative Commons by Attribution logo", "package_id": "6d4475a9-6265-49da-9a1f-e0c5c9358f5c", "position": 3, "resource_locator_function": "", "resource_locator_protocol": "", "resource_type": null, "size": null, "state": "active", "url": "https://i.creativecommons.org/l/by/3.0/88x31.png", "url_type": null, "zip_extract": false}], "tags": [{"display_name": "ADS > Automated DNA Sequencer", "id": "10648197-4451-4d77-80e6-ad650a2650f8", "name": "ADS > Automated DNA Sequencer", "state": "active", "vocabulary_id": null}, {"display_name": "AMD", "id": "dba7c99d-b0de-4b01-b166-360aff9b5053", "name": "AMD", "state": "active", "vocabulary_id": null}, {"display_name": "AMD/AU", "id": "3ea7b640-ce0e-4158-9ae0-c1b4c3467b7c", "name": "AMD/AU", "state": "active", "vocabulary_id": null}, {"display_name": "CEOS", "id": "14765c9b-bc4c-4a36-a3a8-5bc635b910a9", "name": "CEOS", "state": "active", "vocabulary_id": null}, {"display_name": "CONTINENT > ANTARCTICA", "id": "3665ce2e-57eb-4d28-9b51-de889028c0c1", "name": "CONTINENT > ANTARCTICA", "state": "active", "vocabulary_id": null}, {"display_name": "EARTH SCIENCE > BIOLOGICAL CLASSIFICATION > ANIMALS/INVERTEBRATES > ARTHROPODS > CRUSTACEANS > EUPHA", "id": "aa5aad89-b9e6-403e-9d47-1919183b7a4b", "name": "EARTH SCIENCE > BIOLOGICAL CLASSIFICATION > ANIMALS/INVERTEBRATES > ARTHROPODS > CRUSTACEANS > EUPHA", "state": "active", "vocabulary_id": null}, {"display_name": "EARTH SCIENCE > BIOLOGICAL CLASSIFICATION > ANIMALS/VERTEBRATES > FISH", "id": "90d260fd-9e1a-4ca3-a20c-ac68c060e077", "name": "EARTH SCIENCE > BIOLOGICAL CLASSIFICATION > ANIMALS/VERTEBRATES > FISH", "state": "active", "vocabulary_id": null}, {"display_name": "EARTH SCIENCE > BIOLOGICAL CLASSIFICATION > ANIMALS/VERTEBRATES > MAMMALS > CETACEANS", "id": "529d6565-95e6-4253-a940-2f2fe9dbb24d", "name": "EARTH SCIENCE > BIOLOGICAL CLASSIFICATION > ANIMALS/VERTEBRATES > MAMMALS > CETACEANS", "state": "active", "vocabulary_id": null}, {"display_name": "ENVIRONMENTAL DNA", "id": "a7f59fe7-98f5-42d4-ada9-03f782a0dbf1", "name": "ENVIRONMENTAL DNA", "state": "active", "vocabulary_id": null}, {"display_name": "GENETIC SURVEY", "id": "77559a4b-04e6-4507-bb74-10b822ec44f0", "name": "GENETIC SURVEY", "state": "active", "vocabulary_id": null}, {"display_name": "GEOGRAPHIC REGION > POLAR", "id": "3bac0051-c501-49f7-80ab-1484228e2e08", "name": "GEOGRAPHIC REGION > POLAR", "state": "active", "vocabulary_id": null}, {"display_name": "LABORATORY", "id": "5cf666d1-e0bd-4ec8-8ba2-6d59909f474b", "name": "LABORATORY", "state": "active", "vocabulary_id": null}, {"display_name": "METABARCODING", "id": "7af1f3d7-81e3-4b83-828a-4f7fc12d756f", "name": "METABARCODING", "state": "active", "vocabulary_id": null}, {"display_name": "MISEQ", "id": "b5479e65-781d-4f6e-9ff1-56a9f82fa2cf", "name": "MISEQ", "state": "active", "vocabulary_id": null}, {"display_name": "OCEAN > SOUTHERN OCEAN", "id": "04d36312-0409-4eb6-b2c9-7fdd86d4df2b", "name": "OCEAN > SOUTHERN OCEAN", "state": "active", "vocabulary_id": null}, {"display_name": "PCR", "id": "76e5a829-96c5-43b9-bf7a-61bab2bfcc8c", "name": "PCR", "state": "active", "vocabulary_id": null}, {"display_name": "R/V AA > R/V Aurora Australis", "id": "de4abe1a-e3d9-441f-9a59-202a7a2ba802", "name": "R/V AA > R/V Aurora Australis", "state": "active", "vocabulary_id": null}], "groups": [], "relationships_as_subject": [], "relationships_as_object": []}}