-
RNA sequence data from krill CO2 exposure experiment
We use RNA sequencing to investigate which genetic/physiological pathways in Antarctic krill are affected by increased CO2 levels. We carried out larval CO2 exposure experiments... -
Environmental DNA metabarcoding for monitoring metazoan biodiversity in...
Our aim was to compare water and sediment as sources of environmental DNA (eDNA) to better characterise Antarctic benthic communities and further develop practical approaches... -
Short Tailed Shearwater DREAM gene sequencing fastq files
This data set includes unprocessed sample .fastq files from two separate Illumina NextSeq runs, labelled as 'Run_1' and 'Run_2', respectively. Sample names: e.g. STS15059, 'STS'... -
Kelp rafts in the Southern Ocean: intercontinental travel for sessile and...
Metadata record for data from ASAC Project 2914 See the link below for public details on this project. Can animals raft between countries on floating seaweed? We aim to answer... -
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG,... -
Prokaryote 16S rRNA sequence data from antFOCE biofilms
This metadata record contains an Excel spreadsheet with Operational Taxonomic Units (OTUs) gained from 16S rRNA gene sequencing of prokaryotes sampled from Biofilm slides... -
V4 2018 eDNA, genetic CPR and large-volume eDNA raw sequencing data
In this data set we examined whether eDNA samples can detect similar numbers of species and community compositions as genetic continuous plankton recorder (CPR) samples. On the... -
Abatus Microsatellites data set
The present data set corresponds to the genotypes for seven microsatellite markers for three Antarctic sea urchin species of the genus Abatus. Sea urchin individuals were... -
Diversity and evolution of Australian Antarctic sea spiders: Understanding...
Metadata record for data from AAS (ASAC) project 3010. Public Pycnogonids are primitive, bizarre arthropods. Found worldwide, Antarctic pycnogonids are the most diverse,... -
Antarctic Krill Gonad mRNA Transcriptome
RNA was extracted from pooled gonad tissues and tails of five sexually mature males and females, respectively, originating from the krill aquarium at the AAD in Tasmania,... -
Withdrawn metadata record for Antarctic Krill Gonad mRNA Transcriptome
This metadata record was created in error and a DOI assigned to it before the error was noticed. The correct metadata record is available here:... -
Winter diet of Gentoo penguins in South Georgia
See spreadsheets - Gentoo Experiment Details 18s Each number corresponds to each worksheet 1. Samples and Date Gentoo penguin scats were collected from Cumberland Bay, South... -
Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing of...
This metadata record contains an Excel spreadsheet with Operational Taxonomic Units (OTUs) gained from Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing of... -
Krill microbiome
Krill-associated bacterial communities characterised by high-throughput DNA sequencing of the 16S ribosomal RNA gene. The data is decribed in 'Clarke LJ, Suter L, King R,... -
Voyage 4 of the Aurora Australis, 2018 environmental DNA samples analysed...
In March 2018, 23 environmental DNA (eDNA) samples (2 L of filtered seawater) were collected between Hobart, Tasmania and subantarctic Macquarie Island. These samples were... -
eDNA metabarcoding data of a long-distance Southern Ocean transect - RV...
These data accompany the paper 'Long-distance Southern Ocean environmental DNA (eDNA) transect provides insights into spatial marine biota and invasion pathways for non-native... -
Diet results from Adelie penguins at Bechervaise Island and Whitney Point, 2012-2013
These spreadsheets provide the proportions of prey DNA sequences in the scats of Adelie penguins at Bechervaise Island and Whitney Point in East Antarctica. Samples were... -
DNA sequence data collected during the SIPEX II voyage of the Aurora Australis, 2012
Purpose of experiments: Sequence data obtained to determine community structure of pack sea-ice microbial communities and whether it is effected by exposures to elevated CO2... -
Characterising the microbial interactions that drive organic sulphur cycling...
These data come from a set of experiments conducted on the coastal waters near Davis Station in January 2017. The first set of data are from a transect near the Sorsdal glacier... -
K-Axis eukaryote Operational Taxonomic Units (OTU) table and contextual data
Sampling Samples were collected on board the RSV Aurora Australis between 22 January and 17 February 2016. The cruise surveyed the region south of the Kerguelen Plateau...