-
Sea Ice Observations from the Icebird V8 1988/89
These data describe pack ice characteristics in the Antarctic sea ice zone. These data are in the ASPeCt format. National program: Australia Vessel: Ice Bird Dates in ice: 19... -
Breeding populations of Southern Giant Petrels at Heard Island, the McDonald...
This indicator is no longer maintained, and is considered OBSOLETE. INDICATOR DEFINITION The number of breeding pairs of Southern Giant Petrels at Heard Island, the McDonald... -
Diatom and associated data for a field experiment which translocated control...
Full title: Diatom and associated data for a manipulative field experiment which translocated control and contaminated sediments between locations within the Windmill Islands,... -
Thysanoessa macrura: life history parameters and lipid profiles
Zooplankton were collected with a Rectangular Midwater Trawl (RMT 8+1 net) from 37 sampling sites on and near the Southern Kerguelen Plateau. Specimens of the euphausiid... -
Subantarctic zone oceanography - SAZ Project 1997-1998
Data were collected during the 1997-1998 austral summer on voyages by the Aurora Australis and Southern Surveyor. Taken from the abstract of the referenced paper: Oceanographic... -
Seabird band recoveries in the Davis region during the 2015/16 field season
A systematic search for banded Antarctic petrels, Southern fulmars, Cape petrels and Skuas was conducted at Hop Island in the Rauer Group during the 2015/16 field season. Areas... -
U-Pb-Hf zircon data from Bruce Rise and Naturaliste Plateau
These dataset files (2 tables) are supplementary material to: Halpin, J.A., Daczko, N.R., Direen, N.G., Mulder, J.A., Murphy, R.C., Ishihara, T., 2020. Provenance of rifted... -
Aurora Australis Voyage V1 2008/09 Track and Underway Data
This dataset contains the underway data collected during the Aurora Australis Voyage V1 2008/09. Voyage Objectives : Deploy and retrieve personnel - Davis Changeover and... -
Trace elements concentrations measured in bulk sediment samples collected...
Sediment cores were collected from the East Antarctic margin, aboard the Australian Marine National Facility R/V Investigator from January 14th to March 5th 2017 (IN2017_V01;... -
A spatial reference system for coastal ice-free land in East Antarctica
This dataset comprises a table and set of maps of all geographic sites of ice-free land along the East Antarctica coastline between longitudes 37°E and 160°E. Each geographic... -
Supplementary video for 'Internal physiology of live krill revealed using...
This video is supplementary data for the publication entitled 'Internal physiology of live krill revealed using new aquaria techniques and mixed optical microscopy and optical... -
DMS and DMSP Data from CTD and Minicosm experiments conducted during the...
Data Acquisition: Sampling was performed on seawater collected from CTDs and minicosm experiments. Sampling involved the collection of 250 mL of seawater from each Niskin bottle... -
Role of Antarctic marine protists in trophodynamics and global change and...
Locations of sampling sites for ASAC project 40 on rotation 4 of the French polar supply ship L'Astrolabe in the 2010/2011 season. Samples were collected between February and... -
RSV Nuyina Voyage Data 2023-24 V5
Voyage 5 of the 2023/2024 season onboard RSV Nuyina was a commissioning voyage to test scientific instrumentation and systems on board to ensure they were working correctly. The... -
Aurora Australis Voyage 4 1993-94 Underway Data
This dataset contains the underway data from Voyage 4 1993-94 of the Aurora Australis. This was a non-marine science voyage, but NoQalms data types were logged at 20-second... -
Annual report on the scientific work undertaken at Davis Station in 1985
This is a scanned copy of the annual report on the scientific work undertaken at Davis Station in 1985. The report was written by J.B. Gallagher. Paraphrased from the... -
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG,... -
Survey of soft sediment assemblages around Casey Station (Winter grab...
Marine soft-sediment assemblages were sampled from shallow (5 - 35m) nearshore regions around Casey Station, Windmill Islands, East Antarctica in winter 1998, using a van-Veen... -
Quality control toolbox for EM-APEX data (Electromagnetic Autonomous...
The EM-APEX quality control (QC) toolbox provides a framework to quality control CTD and velocity data and calibrate velocity data collected from Electromagnetic Autonomous... -
antFOCE Hard Substrate Fauna data sets
Metadata record AAS_4127_antFOCE_HardSubstrateFauna contains all data sets relating to the fauna sampled from hard substrates during the antFOCE experiment, including...